Search for
Filter By
Rating




Price in $

Computer Science

Here are the best study resources to pass Computer Science. Find Computer Science study guides, notes, assignments, and much more.

Explore Computer Science by Category
EXAM (2985) QUESTIONS & ANSWERS (1696) eBook[PDF] (425) STUDY GUIDE (285) TEST BANKS (185) EXAM REVIEW (173) SOLUTIONS MANUAL (170) Research Paper (96) EXAM PROCTORED (91) AQA QUESTION and MARK SCHEMES (81) FINAL EXAM (78) EXAM/TEST TEMPLATE (74) ESSAY (72) AQA (61) AQA Question Papers (48) MARK SCHEMES (46) Class Notes (42) A-Level Question Paper (40) Summary (37) Edexcel (37) Lab Report (32) Quiz (31) QUESTIONS and ANSWERS (31) PROJECT FINAL (29)
Browse all categories →

  Computer Science  >  STUDY GUIDE  > OSC SWE Operations Specialist Chief E-7 Study Guide | 1363 Questions with 100% Correct Answers | 85 Pages (All)

OSC SWE Operations Specialist Chief E-7 Study Guide | 1363 Questions with 100% Correct Answers | 85 Pages

What is the shape of a C-10315 in an HF block diagram? - ✔✔Square Receive and transmit on separate frequency but not at the same time is an example of what? - ✔✔Half-deplux circuit Receive and tran...

$12.00 85 pages Read more

  Computer Science  >  EXAM  > Final Exam: Progression: Field Tech III - IV Final | 130 Questions with 100% Correct Answers | Updated & Verified (All)

Final Exam: Progression: Field Tech III - IV Final | 130 Questions with 100% Correct Answers | Updated & Verified

The open system interconnection reference model (OSI/R<) Network layer serves which primary function? - ✔✔It uses layer 3 addresses to create multiple routed networks The address 68.56.189.17 belong...

$10.00 14 pages Read more

  Computer Science  >  EXAM  > CIS 3250 FSU Exam II | 100 Questions with 100% Correct Answers | Updated 2023 (All)

CIS 3250 FSU Exam II | 100 Questions with 100% Correct Answers | Updated 2023

A negative right is also known as _______ - ✔✔liberty (T/F) Accelerometers help robots stay upright. - ✔✔True (T/F) A Turing Test determines the strength of an encryption method. - ✔✔False (T/F) Ge...

$10.00 14 pages Read more

  Computer Science  >  EXAM  > CS2100 Computer Organization Tutorial #3: MIPS: Arrays and Instruction Encoding (8 – 12 September 2025) | National University of Singapore (All)

CS2100 Computer Organization Tutorial #3: MIPS: Arrays and Instruction Encoding (8 – 12 September 2025) | National University of Singapore

CS2100 Computer Organization Tutorial #3: MIPS: Arrays and Instruction Encoding (8 – 12 September 2025) | National University of Singapore CS2100 Computer Organization Tutorial #3: MIPS: Arrays and I...

$5.00 4 pages Read more

  Computer Science  >  QUESTIONS & ANSWERS  > University of California, Santa Barbara MCDB 1LLEX2_Question_Set_W21_V2 (All)

University of California, Santa Barbara MCDB 1LLEX2_Question_Set_W21_V2

Exercise 2 Questions Perm: Primers: A: 5’ CCCCACCCTAGGAGAACTTCTCTTT 3’ B: 5’ GTAAGAGTTCCGTAACAGGACAGCT 3’ Q1. Below is the Intron 9 Region of the TPA25- Alu insertion. Highlight where the primers,...

$8.00 5 pages Read more

  Computer Science  >  EXAM  > Wgu d415 sdn exam study set with correct answers 100 verified (All)

Wgu d415 sdn exam study set with correct answers 100 verified

Wgu d415 sdn exam study set with correct answers 100 verified

$6.00 17 pages Read more

  Computer Science  >  QUESTIONS & ANSWERS  > CS 1102 Programming Unit 3 Graded Quiz with Answers- 100% proven pass rate. Latest version 2022 (All)

CS 1102 Programming Unit 3 Graded Quiz with Answers- 100% proven pass rate. Latest version 2022

In Java, a variable can only be used in a program if it has first been: - ☑☑Declared the do while loop repeats a set of code at least once before the condition is tested - ☑☑True The following d...

$8.00 8 pages Read more

  Computer Science  >  EXAM  > COMP 230 Week 8 Final Exam | Latest Update | 100% Correct Solution | Download To Score An A (All)

COMP 230 Week 8 Final Exam | Latest Update | 100% Correct Solution | Download To Score An A

Page 1 (TCO 2) What is an example of a string constant? (TCO 2) What is the assignment operator? (TCO 2) The symbols used to describe the logic of a program are known as _____. (TCO 2) If a variab...

$15.50 14 pages Read more

  Computer Science  >  GCSE QUESTION PAPER  > Pearson Edexcel_GCSE (9–1) Computer Science_1CP1/01 Question Paper 2020 | Principles of Computer Science (All)

Pearson Edexcel_GCSE (9–1) Computer Science_1CP1/01 Question Paper 2020 | Principles of Computer Science

Pearson Edexcel GCSE (9–1) Computer Science 1CP1/01 Question Paper 2020 Principles of Computer Science Monday 11 May 2020 - - - Pearson Edexcel Level 1/Level 2 GCSE (9–1) Computer Science...

$6.50 16 pages Read more

  Computer Science  >  GCSE MARK SCHEME  > Pearson Edexcel_GCSE (9-1) Computer Science_1CP1/02 Mark Scheme 2020 | Application of Computational Thinking (All)

Pearson Edexcel_GCSE (9-1) Computer Science_1CP1/02 Mark Scheme 2020 | Application of Computational Thinking

Pearson Edexcel GCSE (9-1) Computer Science 1CP1/02 Mark Scheme 2020 Application of Computational Thinking - - - Mark Scheme (Results) November 2020 Pearson Edexcel GCSE In Computer Science...

$6.50 25 pages Read more

  Computer Science  >  QUESTIONS & ANSWERS  > Saint Leo University - COM 416Assignment 4 (All)

Saint Leo University - COM 416Assignment 4

COM416 Assignment 4 Q1. Using graphics program, design several security awareness posters on the following themes: updating antivirus signatures, protecting sensitive information, watching out for...

$6.00 0 4 pages Read more

  Computer Science  >  EXAM  > IT460 Systems Analysis And Design Unit 4 Quiz. (All)

IT460 Systems Analysis And Design Unit 4 Quiz.

Question 1 (2 points) Saved A <BLANK> represents the actions or functions a class can perform; can be constructor, query, or update operation; and includes parentheses that may contain special para...

$12.00 13 pages Read more

  Computer Science  >  EXAM  > IT460 Systems Analysis And Design Unit 4 Quiz. (All)

IT460 Systems Analysis And Design Unit 4 Quiz.

Question 1 (2 points) Saved A <BLANK> represents the actions or functions a class can perform; can be constructor, query, or update operation; and includes parentheses that may contain special para...

$11.00 13 pages Read more

  Computer Science  >  EXAM  > (D325) ITEC 3602 Networks - Latest FA Review Q & S 2024 (All)

(D325) ITEC 3602 Networks - Latest FA Review Q & S 2024

(D325) ITEC 3602 Networks - Latest FA Review Q & S 2024(D325) ITEC 3602 Networks - Latest FA Review Q & S 2024(D325) ITEC 3602 Networks - Latest FA Review Q & S 2024(D325) ITEC 3602 Networks - Latest...

$13.00 17 pages Read more

  Computer Science  >  QUESTIONS & ANSWERS  > University of California, Irvine_EECS 148eecs_148_2019_Midterm_solutions-REVIEWED AND EDITED BY EXPERTS 2021 (All)

University of California, Irvine_EECS 148eecs_148_2019_Midterm_solutions-REVIEWED AND EDITED BY EXPERTS 2021

CS 132/EECS 148 Computer Networks - Winter 2019 Midterm Prof. Marco Levorato Full Name: Student ID: Seat no.: Date: February 14th, 2019 • This exam booklet consists of 8 pages: this page, 6 page...

$9.00 0 15 pages Read more

  Computer Science  >  QUESTIONS & ANSWERS  > MIT 511 Multimedia Technology - AMAOEd WEEK 9 LONG QUIZ | 30 Questions & Answers (All)

MIT 511 Multimedia Technology - AMAOEd WEEK 9 LONG QUIZ | 30 Questions & Answers

MIT511-WEEK9-LONG QUIZ quiz 1. Which stage of multimedia application development is concerned with creating outline of the multimedia project? Select one: a.Story Boarding b.Designing c.Script W...

$8.00 3 pages Read more

  Computer Science  >  Class Notes  > WINDOWS Operating Systems (All)

WINDOWS Operating Systems

WINDOWS Operating Systems CS IT COMPUTER SCIENCE INFORMATION TECHNOLOGY MICROSOFT WORD MICROSOFT OFFICE Learning Outcomes A study of this lesson should enable students to: • Identify differen...

$4.00 77 pages Read more

  Computer Science  >  EXAM  > WGU C838 OBJECTIVE ASSESSMENT LATEST 2026 / WGU C838 OA EXAM TEST BANK ACTUAL EXAM 230 QUESTIONS AND CORRECT VERIFIED ANSWERS) |ALREADY GRADED A+ (All)

WGU C838 OBJECTIVE ASSESSMENT LATEST 2026 / WGU C838 OA EXAM TEST BANK ACTUAL EXAM 230 QUESTIONS AND CORRECT VERIFIED ANSWERS) |ALREADY GRADED A+

Prepare thoroughly for the **WGU C838 Objective Assessment (OA) Exam 2026** with this comprehensive **230-question test bank**, designed to reflect the latest WGU C838 exam standards. Already **graded...

$12.00 29 pages Read more

  Computer Science  >  QUESTIONS & ANSWERS  > CSE 551: Foundations of Algorithms - . CSE 551 Practice Quiz 4 Solutions (2021 Fall) (All)

CSE 551: Foundations of Algorithms - . CSE 551 Practice Quiz 4 Solutions (2021 Fall)

CSE 551 Practice Quiz 4 Solutions Jamison Weber June 1, 2021 Question 1 Solve the following recurrence relation using any method. Provide your answer in big-O notation: T (n) = 2T (n2 ) + 1 for n...

$7.50 6 pages Read more

  Computer Science  >  MARK SCHEMES  > GCE Computer Science H446/01: Computer systems A Level Mark Scheme for June 2023 (All)

GCE Computer Science H446/01: Computer systems A Level Mark Scheme for June 2023

GCE Computer Science H446/01: Computer systems A Level Mark Scheme for June 2023 GCE Computer Science H446/01: Computer systems A Level Mark Scheme for June 2023 GCE Computer Science H446/01...

$4.00 34 pages Read more
What is Scholarfriends

Scholarfriends.com Online Platform by Browsegrades Inc. 651N South Broad St, Middletown DE. United States.

Get to know us
About Us
Privacy Statement
Refund Policy
Terms and Conditions
Contact Us
Blog
 HTML Sitemap
 Sellers Directory (A–Z)
We are here to help

We're available through e-mail, Twitter, and live chat.
 FAQ
 Questions? Leave a message!

Follow us on
 Instagram
 Linktree
 X (Twitter)
Useful links
  • Join our Subreddit
  • Solutions Manuals for Accounting, Business, Economics and Management Text Books. The Popular and the Latest.
  • Popular NURSING Test Banks
  • Courses
  • Categories
  • Sellers Directory (A–Z)
  • HTML Sitemap
    • We accept

    payment cards

    Copyright © Scholarfriends · High quality services·